Congratulations Sandy Grimes - Incredible Career

This past week there was a very nice article by Ian Shapira at the Washington Post on Sandy Grimes and her colleague at the CIA - Jeanne Vertefeuille titled:

CIA sisterhood: One spy cared for her dying colleague, an agency pioneer

Together, the two of them wrote a book called:  Circle of Treason: A CIA Account of Traitor Aldrich Ames and the Men He Betrayed.  This is a very touching article on long time friends detailing Sandy taking care of her friend during her final fight with cancer.

The article brought out many interesting facts and this one on Sandy's background I found particularly fascinating:

"Grimes, the daughter of parents who’d worked on the Manhattan Project, joined the agency at the urging of an ex-boyfriend who thought she’d make a “perfect spy.”  "

I first met Sandy in 1988 at a Sun Microsystems Christmas party.   Sandy was/is the wife of Gary Grimes.  Gary was a Sales Director at the time at Sun and later would become VP at Sun in a number of important leadership roles.  Both Gary and Sandy are absolute class acts.    It seems like when I see Gary and Sandy these days it is at funerals for Sun employees or their spouses.  We do see each other at Sun reunions - which are always fun.

The reason for this post, beyond congratulating Sandy on a great career, is that it reminded me of when I did work with Sandy on a "sort of" spy exercise.  OK, it was getting some photos of Gary and the sports cars he had over the years for an April 1st prank we pulled on Gary :-)  I had no idea that when I reached out to Sandy and said to her, "don't tell Gary" that keeping secrets was not a problem for Sandy :-)




Below is part of the April Fool's prank that Sandy helped us pull together.  I grabbed the entire site that John Meyer keeps on his server www.wspot.net, just in case John does not do backups :-)  - as this is a very creative prank.  You should check out the entire site at John's server here - including the FAQ.


GARY GRIMES, FASTEST VICE PRESIDENT ON EARTH, HEADS UP SunCLONETM
 

SunCLONE ONE bio- robotic mid-frame

Gary Grimes, Southern Area Vice President for Sales, has been promoted to President of Sun's newest subsidiary, SunCLONE.  It was extremely important to SMI that we select the right person to lead SunCLONE.  We needed a fast-moving leader to master this dynamic market.  Gary Grimes was selected because, after careful examination, we have determined that Gary is not only the fastest VP at Sun but also on planet Earth.  Gary is the only VP at Sun to have a racing license and could have been a world class driver if he had chosen to pursue a racing career. Gary has driven and owns some of the fastest cars ever produced and we know that the stress of a very fast-moving market would not be a problem for him.  We needed someone who would not be distracted by some of the religious, ethical, privacy, and consumer issues that will undoubtedly crop up with this announcement.  With his laser-like focus on execution, we feel that Gary is the right man for this job.
 
Read the complete announcement e-mail. Visit the live Web Cam.


Building the SunCLONE ONE
For thousands of years, philosophers have pondered the central question of our existence: Are we simply the product of our biological inheritance or do the experiences of our lifetime shape who we are? Today, with the complete mapping of the human genome and the cloning of Dolly, this question has also captured the popular imagination. People from all walks of life -- insurance agents, hot dog vendors, shoe salesmen, water-cooler louts, ignorant drunks and even fans of Temptation Island and AM talk show hosts -- are debating genes vs. learning, DNA vs. experience, Darwin vs. Skinner. In short, Nature vs. Nurture.
 

Dolly (on right) with unnamed lamb

Throughout history the Nature vs. Nurture debate has occupied and stumped brilliant scholars and crackpots alike. It took the incendiary brilliance of the super-geniuses at Sun's SundEnPjMsF subsidiary to realize that this question deserved not an answer, but a rebuttal. Nature and Nurture are two sides of the same coin and, when trying to capture the entire human, both sides must be considered.
 
It was this philosophical, metaphysical breakthrough which made the SunCLONE ONE possible. By combining both Nature, in the form of JDNA Enterprise Java Beans (EJBs), and Nurture, in the form of JMRI brain scans, the SunCLONE ONE achieves a holistic synthesis, exactly replicating its human base unit.
 

JDNA - Nature and Java Together For The First Time

Human Chromosome Number 3, showing the sales rep gene

The making of a SunCLONE ONE starts with the painless extraction of the 23 chromosome pairs which comprise the complete DNA code of the human base unit. This DNA is then amplified using the Nobel Prize-winning Polymerase Chain Reaction (PCR) process. After amplification, the human base unit's DNA is passed to a nucleotide sequencing machine which reads the code's base pairs. This nucleotide sequence is then stored in a central 2⁴³⁵-dimensional data warehouse which is used for cutting edge scientific and marketing research (see our Privacy Policy).
 

DNA extraction via micro-needle

DNA for the SunCLONE ONE is extracted using a micro-needle probe no larger than 1/42 the width of a human hair. The micro-needle pierces the donor cell's nucleus and gently sucks out its chromosomes. Previously, this delicate procedure could only be performed by highly-trained technicians in a clean-room environment. But in an amazing display of eating our own dog food, the SunCLONE ONE Home DNA Extraction kit uses robotic technology developed for the SunCLONE ONE product to allow easy and painless DNA sucking in the privacy of your own home.
 

JDNA Source Code

import javax.jdna.Genome; public class GaryGrimes extends Genome {         Genome genes = new Genome( "CGTACCGCGCTAATCGTTTCTGAAGCTCGA\ CTGTCTGATGCTCGTAAAGCCGATCTACTAG\ CCGCTAGATAATAGCTAGAAGTTGCAGCTGC\ CGTAAACCATGCTGGTAAGTAGCTAGCATGG\ CTCTCGATAGATCDAVESTINKSACAGTCAA\ CGCTGAATAACAGCATAGCATATTTCACGTA...

Using jdnac, Sun's patented DNA-to-Java compiler, the organic DNA is converted into Java source code. The resulting Java class files use the JDNA Java extension to map the function of human biological processes onto the bio-robotic SunCLONE ONE device.
JDNA EJBs, which were developed using the highly successful Java Community Process, are part of the Java 2 Biological Edition (J2BE). Each SunCLONE ONE includes an iPlanet J2BE application server which executes in a massively parallel fashion on the 340x10³⁶ MAJC processors comprising the SunCLONE ONE midframe. This amazing assemblage exactly duplicates the human base unit's biologic make-up, without any of the inconvenient drawbacks of biological instantiation: hunger, thirst, pain, and so forth.
 

JMRI - Yes, We Can Read Your Mind

Duplicating the human base unit's DNA is relatively straightforward, but how could we possibly capture the lifetime of learning that makes even genetically identical twins unique human beings? One way would be to exactly duplicate the human base unit's life, exposing the SunCLONE ONE to the same experiences and formative factors. While that might succeed, it's way too much work and it lacks the instant gratification so important in today's fast-changing markets. Instead, we simply "rip" those experiences from the human, using a process analogous to "ripping" a music CD into an MP3 file.
 

Actual scan of Gary Grimes's brain, not actual size.

JMRI brain scans enable this ripping process. Extremely high-detail MRI scans of the human's brain allow us to exactly map the web of neural connections which encode his personality. In less than 0.4 seconds, an entire lifetime of hopes, dreams, loves and disappointments are converted into a simple and easily manipulated Java source file using the JMRI extention. This JMRI code, when combined with the appropriate JDNA EJBs and SunCLONE ONE's distributed, massively parallel MAJC-based architecture, forms the "brain" of the SunCLONE ONE.

Mass Market Cloning Today!

Bulky MRI Dinosaur

Traditional MRI scanners are large, uncomfortable and expensive. Since the SunCLONE ONE is intended to be a mass market, consumer product, SundEnPjMsF was forced to find an innovative, new way of capturing the needed brain scans. Working through the Java Community Process, Sun and major MRI and point-of-sales device manufacturers were able to miniaturize the traditional MRI scanner and incorporate it into a common checkout line cash register.

JMRI-equipped cash register

Today, over 93% of all stores in the United States are equipped with these sophisticated devices. Every time you complete a credit card purchase at one of these registers, a new, up-to-date scan of your brain is transmitted to Sun's central data warehouse (see our Privacy Policy). You don't have to do anything else. In fact, chances are your brain scan is already on file with Sun (see our Privacy Policy). By continually updating your SunCLONE ONE brain profile, we ensure that your SunCLONE ONE is equipped with the most complete and accurate representation of your personality possible.
 

Putting It All Together

Actual photo-micrograph of Gary Grimes's DNA

Duplicating the mind of the human base unit is only half the problem. We must also build a suitable body. While early beta units used a human body, for the production SunCLONE ONE we have chosen a bio-robotic technology which offers many advantages over the hundreds of pounds of meat typically used to house a human intellect. For example, your SunCLONE ONE requires neither food nor rest and is totally exempt from most labor and human rights laws. The SunCLONE ONE's body uses the latest in self-organizing criticality, atto-technology and molecular self-assembly to create the perfect merger of human creativity and relentless machine perfection (see our Disclaimer). With Nature and Nurture housed in a perfect, nigh-invulnerable body, the SunCLONE ONE is the perfect answer to many questions which man was not meant to ask!
 



Meet SMI's newest subsidiary, SundEnPjMsF, the brilliant minds behind the SunCLONE ONE (from left to right):

• Neil Pierson, Java MRI Real-Time Imaging Architect (JMRIA)
• John Meyer, Java Physicist and Quantum Computing Architect (JPQCA);
• Dave Edstrom, Chief Genius and Technology Architect (CGTA);
• Steve Fritzinger, Java DNA Neurosurgeon Architect (JDNAC)

  Not pictured are the persons formerly known as "Sandy Grimes", "Dick Bowman", "Steve Ferry", "Jim Clifton", "Pat Cox", "Sue", "Tal" and "Marty" "Walls" and the entire Viva Robotics corporation who have all entered the Federal Witness Protection Program. Also not pictured is Julie Edstrom, former Chief MRI Imaging Scientist and the only one in the group with any ethics at all.

Happy 70th Birthday Chris Easter!

Julie and I went to LaPlata, Maryland yesterday afternoon for a surprise birthday party for Chris Easter.   Chris and I worked together at Sun Microsystems back in the late 90s and early 00s.   Chris and I both worked for Sue Walls back then as well.

Chris and I got along great from day one because we both loved a great story.  Chris, however, could take things to a whole new level as was pointed out yesterday at her surprise 70th birthday party at Grace Lutheran Church in LaPlata. 

As Sue pointed out when she shared a few stories on Chris, Chris has no problem telling even her grandchildren remarkable stories about herself.

For example:

Chris is taking her nine year old granddaughter to New York City to see the famous Rockettes.  On the way there, Chris mentions to her granddaughter that when Chris was young, she was a Rockette.  Her granddaughter could not be more proud!  They had a great time.  A few weeks later Chris's daughter Lynn calls Chris.  The conversation goes like this, "Mom, your granddaughter got an "A" on a paper she wrote."   Chris, said "that's great!"   Lynn went on to say, "Yes, she wrote about you being a Rockette.   Mom, you can't keep telling my kids these stories about yourself that just aren't true."

Another example of Chris telling her grandchildren story was when they were young, Chris convinced that she was the only gold medal winner at the olympics in both figure skating and swimming.  

At a Blue Angels Air Show, two young boys sitting behind Chris said they could not see the person speaking before the jets were to take off and do their incredible array of aerial stunts.   Chris turned around and said to the boys and their parents, "do you know who I am?"   "No", the boys replied.  Chris then said, "I am the first woman Admiral in the Navy and the first woman pilot of the Blue Angels."   The young boys and their parents were very impressed!

That is me and Chris above.  Sue and Lynn gave nice talks discussing Lynn's many "exploits" and gave her medals and pins to honor her. 

It was a great time and there is not a nicer or funnier lady on planet earth than Chris Easter.  Happy 70th Birthday Chris and many, many more!